========================================== mpa.ProfileMut ========================================== **Overview** It is often useful to compute the mutation rate within a set of sequences, e.g., in order to validate the composition of a library. This can be accomplished using the profile mut class as follows: **Usage** >>> import mpathic as mpa >>> mpa.ProfileMut(dataset_df = valid_dataset) **Example Input**:: ct seq 259 TAATGTGAGTTAGCTCACTCAT 41 TAAAGTGAGTTAGCTCACTCAT 36 TAATGTGAGTAAGCTCACTCAT 35 TAGTGTGAGTTAGCTCACTCAT 34 TAATGTTAGTTAGCTCACTCAT 34 TTATGTGAGTTAGCTCACTCAT ... **Example Output**:: pos wt mut 0 0 T 0.23819 1 1 A 0.24141 2 2 A 0.24118 3 3 T 0.24016 4 4 G 0.24093 5 5 T 0.24001 ... Class Details ------------- .. autoclass:: profile_mut.ProfileMut :members: